Human PKM cDNA Clone in Mammalian Expression Vector
(2 references)
Quick Overview for Human PKM cDNA Clone in Mammalian Expression Vector (ABIN3379424)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc315792
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PKM is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2550 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human PKM cDNA Clone in Mammalian Expression Vector]()
Human PKM cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Mouse PKM cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse PKM cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Rat PKM cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Rat PKM cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human PKM cDNA Clone in Mammalian Expression Vector]()
Human PKM cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Reciprocal regulation of protein kinase and pyruvate kinase activities of pyruvate kinase M2 by growth signals." in: The Journal of biological chemistry, Vol. 288, Issue 22, pp. 15971-9, (2013) (PubMed).
: "Pharmacologic activation of PKM2 slows lung tumor xenograft growth." in: Molecular cancer therapeutics, Vol. 12, Issue 8, pp. 1453-60, (2013) (PubMed).
-
: "Reciprocal regulation of protein kinase and pyruvate kinase activities of pyruvate kinase M2 by growth signals." in: The Journal of biological chemistry, Vol. 288, Issue 22, pp. 15971-9, (2013) (PubMed).
-
- PKM (Pyruvate Kinase M1/2 (PKM))
-
Alternative Name
- PKM
-
Background
- This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011].Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence and has an alternate in-frame coding exon compared to variant 4. The resulting isoform (a, also called M2) is shorter at the N-terminus and has a different internal segment compared to isoform c.
-
NCBI Accession
- NM_002654, NP_002645
Target
-
