Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human POU5F1 cDNA Clone in Mammalian Expression Vector

This is a POU Class 5 Homeobox 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379487
Supplier Product No.: sc125252
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human POU5F1 cDNA Clone in Mammalian Expression Vector (ABIN3379487)

Gene

OCT4 (POU5F1) (POU Class 5 Homeobox 1 (POU5F1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125252

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human POU5F1/OCT4 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Higashi, Imamura, Fudo, Uemura, Saiki, Hoshino, Toida, Kashiwagi, Igarashi: "Identification of functional amino acid residues involved in polyamine and agmatine transport by human organic cation transporter 2." in: PLoS ONE, Vol. 9, Issue 7, pp. e102234, (2014) (PubMed).

    Yokoo, Masuda, Yonezawa, Terada, Katsura, Inui: "Significance of organic cation transporter 3 (SLC22A3) expression for the cytotoxic effect of oxaliplatin in colorectal cancer." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 36, Issue 11, pp. 2299-306, (2008) (PubMed).

  • Target

    OCT4 (POU5F1) (POU Class 5 Homeobox 1 (POU5F1))

    Alternative Name

    POU5F1/OCT4

    Background

    This gene encodes a transcription factor containing a POU homeodomain that plays a key role in embryonic development and stem cell pluripotency. Aberrant expression of this gene in adult tissues is associated with tumorigenesis. This gene can participate in a translocation with the Ewing's sarcoma gene on chromosome 21, which also leads to tumor formation. Alternative splicing, as well as usage of alternative AUG and non-AUG translation initiation codons, results in multiple isoforms. One of the AUG start codons is polymorphic in human populations. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Oct 2013].Transcript Variant: This variant (1, also known as OCT4A) represents the shortest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_002701, NP_002692
You are here: