Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human RAD51 cDNA Clone in Mammalian Expression Vector

This is a DNA Repair Protein Homolog 1 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379685
Supplier Product No.: sc309019
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human RAD51 cDNA Clone in Mammalian Expression Vector (ABIN3379685)

Gene

RAD51 (DNA Repair Protein Homolog 1 (RAD51))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc309019

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human RAD51 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Gasparini, Lovat, Fassan, Casadei, Cascione, Jacob, Carasi, Palmieri, Costinean, Shapiro, Huebner, Croce: "Protective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiation." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 111, Issue 12, pp. 4536-41, (2014) (PubMed).

  • Target

    RAD51 (DNA Repair Protein Homolog 1 (RAD51))

    Alternative Name

    RAD51

    Background

    The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009].Transcript Variant: This variant (1) uses an alternate exon in the 5' coding region, compared to variant 2. The resulting isoform (1) contains a distinct segment near the N-terminus, compared to isoform 2.

    NCBI Accession

    NM_002875, NP_002866
You are here: