Human ROBO1 cDNA Clone in Mammalian Expression Vector
This is a Roundabout, Axon Guidance Receptor, Homolog 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 7300 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3379828
Supplier Product No.: sc109740
$2,048.31
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ROBO1 cDNA Clone in Mammalian Expression Vector (ABIN3379828)
Gene
ROBO1
(Roundabout, Axon Guidance Receptor, Homolog 1 (ROBO1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc109740
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ROBO1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 7300 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Loss of Git2 induces epithelial-mesenchymal transition by miR146a-Cnot6L-controlled expression of Zeb1." in: Journal of cell science, Vol. 126, Issue Pt 12, pp. 2740-6, (2013) (PubMed).
: "Slit-Robo signaling induces malignant transformation through Hakai-mediated E-cadherin degradation during colorectal epithelial cell carcinogenesis." in: Cell research, Vol. 21, Issue 4, pp. 609-26, (2011) (PubMed).
-
: "Loss of Git2 induces epithelial-mesenchymal transition by miR146a-Cnot6L-controlled expression of Zeb1." in: Journal of cell science, Vol. 126, Issue Pt 12, pp. 2740-6, (2013) (PubMed).
-
- ROBO1 (Roundabout, Axon Guidance Receptor, Homolog 1 (ROBO1))
-
Alternative Name
- ROBO1
-
Background
- Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009].Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR, uses a distinct translation start site, includes an alternate in-frame exon in the 5' coding region, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus, compared to isoform a. The 5' UTR of this variant contains a 55 aa uORF with a strong Kozak signal that may inhibit translation of this protein.
-
NCBI Accession
- NM_133631, NP_598334
Target
-
You are here:
