Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human RUNX1 cDNA Clone in Mammalian Expression Vector

This is a Runt-Related Transcription Factor 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379868
Supplier Product No.: sc106348
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human RUNX1 cDNA Clone in Mammalian Expression Vector (ABIN3379868)

Gene

RUNX1 (Runt-Related Transcription Factor 1 (RUNX1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc106348

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human RUNX1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Jalagadugula, Mao, Kaur, Dhanasekaran, Rao: "Platelet protein kinase C-theta deficiency with human RUNX1 mutation: PRKCQ is a transcriptional target of RUNX1." in: Arteriosclerosis, thrombosis, and vascular biology, Vol. 31, Issue 4, pp. 921-7, (2011) (PubMed).

    Kaur, Jalagadugula, Mao, Rao: "RUNX1/core binding factor A2 regulates platelet 12-lipoxygenase gene (ALOX12): studies in human RUNX1 haplodeficiency." in: Blood, Vol. 115, Issue 15, pp. 3128-35, (2010) (PubMed).

    Wang, Schwemmers, Hexner, Pahl: "AML1 is overexpressed in patients with myeloproliferative neoplasms and mediates JAK2V617F-independent overexpression of NF-E2." in: Blood, Vol. 116, Issue 2, pp. 254-66, (2010) (PubMed).

    Jalagadugula, Mao, Kaur, Goldfinger, Dhanasekaran, Rao: "Regulation of platelet myosin light chain (MYL9) by RUNX1: implications for thrombocytopenia and platelet dysfunction in RUNX1 haplodeficiency." in: Blood, Vol. 116, Issue 26, pp. 6037-45, (2010) (PubMed).

  • Target

    RUNX1 (Runt-Related Transcription Factor 1 (RUNX1))

    Alternative Name

    RUNX1

    Background

    Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (AML1b) is shorter and has a distinct N-terminus compared to isoform AML1c.

    NCBI Accession

    NM_001001890, NP_001001890
You are here: