Human RUNX1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human RUNX1 cDNA Clone in Mammalian Expression Vector (ABIN3379868)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc106348
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human RUNX1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1700 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Platelet protein kinase C-theta deficiency with human RUNX1 mutation: PRKCQ is a transcriptional target of RUNX1." in: Arteriosclerosis, thrombosis, and vascular biology, Vol. 31, Issue 4, pp. 921-7, (2011) (PubMed).
: "RUNX1/core binding factor A2 regulates platelet 12-lipoxygenase gene (ALOX12): studies in human RUNX1 haplodeficiency." in: Blood, Vol. 115, Issue 15, pp. 3128-35, (2010) (PubMed).
: "AML1 is overexpressed in patients with myeloproliferative neoplasms and mediates JAK2V617F-independent overexpression of NF-E2." in: Blood, Vol. 116, Issue 2, pp. 254-66, (2010) (PubMed).
: "Regulation of platelet myosin light chain (MYL9) by RUNX1: implications for thrombocytopenia and platelet dysfunction in RUNX1 haplodeficiency." in: Blood, Vol. 116, Issue 26, pp. 6037-45, (2010) (PubMed).
-
: "Platelet protein kinase C-theta deficiency with human RUNX1 mutation: PRKCQ is a transcriptional target of RUNX1." in: Arteriosclerosis, thrombosis, and vascular biology, Vol. 31, Issue 4, pp. 921-7, (2011) (PubMed).
-
- RUNX1 (Runt-Related Transcription Factor 1 (RUNX1))
-
Alternative Name
- RUNX1
-
Background
- Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (AML1b) is shorter and has a distinct N-terminus compared to isoform AML1c.
-
NCBI Accession
- NM_001001890, NP_001001890
Target
-