Human RXRA cDNA Clone in Mammalian Expression Vector
This is a Retinoid X Receptor, alpha plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1600 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3379874
Supplier Product No.: sc118299
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human RXRA cDNA Clone in Mammalian Expression Vector (ABIN3379874)
Gene
Retinoid X Receptor alpha (RXRA)
(Retinoid X Receptor, alpha (RXRA))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118299
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human RXRA is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Transient Maternal Hypothyroxinemia Potentiates the Transcriptional Response to Exogenous Thyroid Hormone in the Fetal Cerebral Cortex Before the Onset of Fetal Thyroid Function: A Messenger and ..." in: Cerebral cortex (New York, N.Y. : 1991), Vol. 25, Issue 7, pp. 1735-45, (2015) (PubMed).
: "Differential activation of human constitutive androstane receptor and its SV23 and SV24 splice variants by rilpivirine and etravirine." in: British journal of pharmacology, Vol. 172, Issue 5, pp. 1263-76, (2015) (PubMed).
: "Fetal bovine serum and human constitutive androstane receptor: evidence for activation of the SV23 splice variant by artemisinin, artemether, and arteether in a serum-free cell culture system." in: Toxicology and applied pharmacology, Vol. 277, Issue 2, pp. 221-30, (2014) (PubMed).
: "Differential effect of meclizine on the activity of human pregnane X receptor and constitutive androstane receptor." in: The Journal of pharmacology and experimental therapeutics, Vol. 336, Issue 3, pp. 816-26, (2011) (PubMed).
: "Isoform-selective activation of human constitutive androstane receptor by Ginkgo biloba extract: functional analysis of the SV23, SV24, and SV25 splice variants." in: The Journal of pharmacology and experimental therapeutics, Vol. 339, Issue 2, pp. 704-15, (2011) (PubMed).
: "Olfactomedin 4 is a novel target gene of retinoic acids and 5-aza-2'-deoxycytidine involved in human myeloid leukemia cell growth, differentiation, and apoptosis." in: Blood, Vol. 116, Issue 23, pp. 4938-47, (2010) (PubMed).
-
: "Transient Maternal Hypothyroxinemia Potentiates the Transcriptional Response to Exogenous Thyroid Hormone in the Fetal Cerebral Cortex Before the Onset of Fetal Thyroid Function: A Messenger and ..." in: Cerebral cortex (New York, N.Y. : 1991), Vol. 25, Issue 7, pp. 1735-45, (2015) (PubMed).
-
- Retinoid X Receptor alpha (RXRA) (Retinoid X Receptor, alpha (RXRA))
-
Alternative Name
- RXRA
-
Background
- Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014].Transcript Variant: This variant (1) encodes the longest isoform (a).
-
NCBI Accession
- NM_002957, NP_002948
Target
-
You are here:
