Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SIRT1 cDNA Clone in Mammalian Expression Vector

This is a Sirtuin 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379988
Supplier Product No.: sc127917
$1,016.73
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SIRT1 cDNA Clone in Mammalian Expression Vector (ABIN3379988)

Gene

SIRT1 (Sirtuin 1 (SIRT1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc127917

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SIRT1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Ishikawa, He, Terasaki, Nazari, Zhang, Spee, Kannan, Hinton: "Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy." in: Scientific reports, Vol. 5, pp. 16386, (2015) (PubMed).

    Smith, Syed, Lukacsovich, Purcell, Barbaro, Worthge, Wei, Pollio, Magnoni, Scali, Massai, Franceschini, Camarri, Gianfriddo, Diodato, Thomas, Gokce, Tabrizi, Caricasole, Landwehrmeyer, Menalled et al.: "A potent and selective Sirtuin 1 inhibitor alleviates pathology in multiple animal and cell models of Huntington's disease. ..." in: Human molecular genetics, Vol. 23, Issue 11, pp. 2995-3007, (2014) (PubMed).

    Nimmagadda, Bever, Vattikunta, Talat, Ahmad, Nagalla, Trisler, Judge, Royal, Chandrasekaran, Russell, Makar: "Overexpression of SIRT1 protein in neurons protects against experimental autoimmune encephalomyelitis through activation of multiple SIRT1 targets." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 190, Issue 9, pp. 4595-607, (2013) (PubMed).

    Frampton, Ueno, Quinn, McMillin, Pae, Galindo, Leyva-Illades, DeMorrow: "The novel growth factor, progranulin, stimulates mouse cholangiocyte proliferation via sirtuin-1-mediated inactivation of FOXO1." in: American journal of physiology. Gastrointestinal and liver physiology, Vol. 303, Issue 11, pp. G1202-11, (2012) (PubMed).

  • Target

    SIRT1 (Sirtuin 1 (SIRT1))

    Alternative Name

    SIRT1

    Background

    This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined, however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

    NCBI Accession

    NM_012238, NP_036370
You are here: