Human SLC10A1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human SLC10A1 cDNA Clone in Mammalian Expression Vector (ABIN3379997)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118232
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SLC10A1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1750 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Hepatitis B and D viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes." in: Gastroenterology, Vol. 146, Issue 4, pp. 1070-83, (2014) (PubMed).
: "(-)-Epigallocatechin-3-gallate inhibits entry of hepatitis B virus into hepatocytes." in: Antiviral research, Vol. 111, pp. 100-11, (2014) (PubMed).
: "Binding of hepatitis B virus to its cellular receptor alters the expression profile of genes of bile acid metabolism." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1483-93, (2014) (PubMed).
: "Activation of nuclear factor (erythroid-2 like) factor 2 by toxic bile acids provokes adaptive defense responses to enhance cell survival at the emergence of oxidative stress." in: Molecular pharmacology, Vol. 72, Issue 5, pp. 1380-90, (2007) (PubMed).
-
-
- SLC10A1 (Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 1 (SLC10A1))
-
Alternative Name
- SLC10A1
-
Background
- The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids, the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011].
-
NCBI Accession
- NM_003049, NP_003040
Target
-