Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLC10A1 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1750 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379997
Supplier Product No.: sc118232
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLC10A1 cDNA Clone in Mammalian Expression Vector (ABIN3379997)

Gene

SLC10A1 (Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 1 (SLC10A1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118232

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLC10A1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1750 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Ni, Lempp, Mehrle, Nkongolo, Kaufman, Fälth, Stindt, Königer, Nassal, Kubitz, Sültmann, Urban: "Hepatitis B and D viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes." in: Gastroenterology, Vol. 146, Issue 4, pp. 1070-83, (2014) (PubMed).

    Huang, Tao, Hung, Chen, Lin, Huang: "(-)-Epigallocatechin-3-gallate inhibits entry of hepatitis B virus into hepatocytes." in: Antiviral research, Vol. 111, pp. 100-11, (2014) (PubMed).

    Oehler, Volz, Bhadra, Kah, Allweiss, Giersch, Bierwolf, Riecken, Pollok, Lohse, Fehse, Petersen, Urban, Lütgehetmann, Heeren, Dandri: "Binding of hepatitis B virus to its cellular receptor alters the expression profile of genes of bile acid metabolism." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1483-93, (2014) (PubMed).

    Tan, Yang, Ito: "Activation of nuclear factor (erythroid-2 like) factor 2 by toxic bile acids provokes adaptive defense responses to enhance cell survival at the emergence of oxidative stress." in: Molecular pharmacology, Vol. 72, Issue 5, pp. 1380-90, (2007) (PubMed).

  • Target

    SLC10A1 (Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 1 (SLC10A1))

    Alternative Name

    SLC10A1

    Background

    The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids, the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011].

    NCBI Accession

    NM_003049, NP_003040
You are here: