Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLCO2B1 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Organic Anion Transporter Family, Member 2B1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4130 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380068
Supplier Product No.: sc115618
$965.25
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLCO2B1 cDNA Clone in Mammalian Expression Vector (ABIN3380068)

Gene

SLCO2B1 (Solute Carrier Organic Anion Transporter Family, Member 2B1 (SLCO2B1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115618

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLCO2B1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4130 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wang, Harshman, Xie, Nakabayashi, Qu, Pomerantz, Lee, Kantoff: "Association of SLCO2B1 Genotypes With Time to Progression and Overall Survival in Patients Receiving Androgen-Deprivation Therapy for Prostate Cancer." in: Journal of clinical oncology : official journal of the American Society of Clinical Oncology, Vol. 34, Issue 4, pp. 352-9, (2016) (PubMed).

    Green, Kaipainen, Bullock, Zhang, Lucas, Matson, Banks, Mostaghel: "Role of OATP transporters in steroid uptake by prostate cancer cells in vivo." in: Prostate cancer and prostatic diseases, (2016) (PubMed).

    Leuthold, Hagenbuch, Mohebbi, Wagner, Meier, Stieger: "Mechanisms of pH-gradient driven transport mediated by organic anion polypeptide transporters." in: American journal of physiology. Cell physiology, Vol. 296, Issue 3, pp. C570-82, (2009) (PubMed).

    Lan, Rao, Haywood, Davis, Han, Garver, Dawson: "Interaction of macrolide antibiotics with intestinally expressed human and rat organic anion-transporting polypeptides." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 37, Issue 12, pp. 2375-82, (2009) (PubMed).

  • Target

    SLCO2B1 (Solute Carrier Organic Anion Transporter Family, Member 2B1 (SLCO2B1))

    Alternative Name

    SLCO2B1

    Background

    This locus encodes a member of the organic anion-transporting polypeptide family of membrane proteins. The protein encoded by this locus may function in regulation of placental uptake of sulfated steroids. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_007256, NP_009187
You are here: