Human STAT3 cDNA Clone in Mammalian Expression Vector
This is a Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) plasmid from OriGene - 7 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3384 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(7 references)
Catalog No. ABIN3380197
Supplier Product No.: sc124165
$1,048.41
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human STAT3 cDNA Clone in Mammalian Expression Vector (ABIN3380197)
Gene
STAT3
(Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc124165
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human STAT3 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3384 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "STAT3-induced WDR1 overexpression promotes breast cancer cell migration." in: Cellular signalling, Vol. 28, Issue 11, pp. 1753-60, (2016) (PubMed).
: "At High Levels, Constitutively Activated STAT3 Induces Apoptosis of Chronic Lymphocytic Leukemia Cells." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 196, Issue 10, pp. 4400-9, (2016) (PubMed).
: "MafB is a downstream target of the IL-10/STAT3 signaling pathway, involved in the regulation of macrophage de-activation." in: Biochimica et biophysica acta, Vol. 1843, Issue 5, pp. 955-64, (2014) (PubMed).
: "Modulation of vascular smooth muscle cell phenotype by STAT-1 and STAT-3." in: Atherosclerosis, Vol. 234, Issue 1, pp. 169-75, (2014) (PubMed).
: "Hepatitis C virus-induced changes in microRNA 107 (miRNA-107) and miRNA-449a modulate CCL2 by targeting the interleukin-6 receptor complex in hepatitis." in: Journal of virology, Vol. 88, Issue 7, pp. 3733-43, (2014) (PubMed).
: "S-glutathionylation impairs signal transducer and activator of transcription 3 activation and signaling." in: Endocrinology, Vol. 150, Issue 3, pp. 1122-31, (2009) (PubMed).
: "The proinflammatory cytokine, interleukin-6, up-regulates calcium-sensing receptor gene transcription via Stat1/3 and Sp1/3." in: The Journal of biological chemistry, Vol. 283, Issue 20, pp. 13586-600, (2008) (PubMed).
-
-
- STAT3 (Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3))
-
Alternative Name
- STAT3
-
Background
- The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) represents the longest transcript, and encodes the longest isoform (1).
-
NCBI Accession
- NM_139276, NP_644805
Target
-
You are here:
