Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human STAU1 cDNA Clone in Mammalian Expression Vector

This is a Staufen Double-Stranded RNA Binding Protein 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380199
Supplier Product No.: sc109798
$532.62
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human STAU1 cDNA Clone in Mammalian Expression Vector (ABIN3380199)

Gene

STAU1/Staufen (STAU1) (Staufen Double-Stranded RNA Binding Protein 1 (STAU1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109798

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human STAU1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    STAU1/Staufen (STAU1) (Staufen Double-Stranded RNA Binding Protein 1 (STAU1))

    Alternative Name

    STAU1

    Background

    Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (T3) has an additional exon in the 5' region, compared to T2, the most abundantly expressed transcript variant. This introduces an AUG initiation codon upstream of the one found in T2, causing T3 to encode a protein isoform (b) of 577 amino acids that is 81 amino acids longer at the N-terminal end.

    NCBI Accession

    NM_017453, NP_059347
You are here: