Human TAF9 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human TAF9 cDNA Clone in Mammalian Expression Vector (ABIN3380260)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc127231
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TAF9 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1250 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- TAF9 (RNA Polymerase II TBP-Associated Factor Subunit G (TAF9))
-
Alternative Name
- TAF9
-
Background
- Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013].Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 4. Both variants 4 and 1 encode the same protein.
-
NCBI Accession
- NM_003187, NP_003178
Target
-