Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TGFB1 cDNA Clone in Mammalian Expression Vector

This is a Transforming Growth Factor, beta 1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1870 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380315
Supplier Product No.: sc119746
$754.60
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TGFB1 cDNA Clone in Mammalian Expression Vector (ABIN3380315)

Gene

TGFB1 (Transforming Growth Factor, beta 1 (TGFB1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119746

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TGFB1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1870 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Lamar, Miller, Dellefave-Castillo, McNally: "Genotype-Specific Interaction of Latent TGFβ Binding Protein 4 with TGFβ." in: PLoS ONE, Vol. 11, Issue 2, pp. e0150358, (2016) (PubMed).

    Hong, Yu, Geng, Duan, Zheng, Fan, Chen, Wu: "High Concentrations of Uric Acid Inhibit Endothelial Cell Migration via miR-663 Which Regulates Phosphatase and Tensin Homolog by Targeting Transforming Growth Factor-β1." in: Microcirculation (New York, N.Y. : 1994), Vol. 22, Issue 4, pp. 306-14, (2015) (PubMed).

    Dogar, Semplicio, Guennewig, Hall: "Multiple microRNAs derived from chemically synthesized precursors regulate thrombospondin 1 expression." in: Nucleic acid therapeutics, Vol. 24, Issue 2, pp. 149-59, (2014) (PubMed).

    Shiga, Nozaki, Yokoseki, Nihonmatsu, Kawata, Kato, Koyama, Arima, Ikeda, Katada, Toyoshima, Takahashi, Tanaka, Nakano, Ikeuchi, Nishizawa, Onodera: "Cerebral small-vessel disease protein HTRA1 controls the amount of TGF-β1 via cleavage of proTGF-β1." in: Human molecular genetics, Vol. 20, Issue 9, pp. 1800-10, (2011) (PubMed).

    Dogar, Towbin, Hall: "Suppression of latent transforming growth factor (TGF)-beta1 restores growth inhibitory TGF-beta signaling through microRNAs." in: The Journal of biological chemistry, Vol. 286, Issue 18, pp. 16447-58, (2011) (PubMed).

  • Target

    TGFB1 (Transforming Growth Factor, beta 1 (TGFB1))

    Alternative Name

    TGFB1

    Background

    This gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, which are multifunctional peptides that regulate proliferation, differentiation, adhesion, migration, and other functions in many cell types. Many cells have TGFB receptors, and the protein positively and negatively regulates many other growth factors. The secreted protein is cleaved into a latency-associated peptide (LAP) and a mature TGFB1 peptide, and is found in either a latent form composed of a TGFB1 homodimer, a LAP homodimer, and a latent TGFB1-binding protein, or in an active form composed of a TGFB1 homodimer. The mature peptide may also form heterodimers with other TGFB family members. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease.[provided by RefSeq, Oct 2009].

    NCBI Accession

    NM_000660, NP_000651
You are here: