Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TRAF6 cDNA Clone in Mammalian Expression Vector

This is a TNF Receptor-Associated Factor 6 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4470 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380442
Supplier Product No.: sc109844
$482.13
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human TRAF6 cDNA Clone in Mammalian Expression Vector (ABIN3380442)

Gene

TRAF6 (TNF Receptor-Associated Factor 6 (TRAF6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109844

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4470 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Park, Huang, Lu, Cairo, Zhou: "MicroRNA-146a and microRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteins." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2831-41, (2015) (PubMed).

  • Target

    TRAF6 (TNF Receptor-Associated Factor 6 (TRAF6))

    Alternative Name

    TRAF6

    Background

    The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. [provided by RefSeq, Feb 2012].Transcript Variant: This variant (2) lacks a segment in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.

    NCBI Accession

    NM_004620, NP_004611
You are here: