Human TRPA1 cDNA Clone in Mammalian Expression Vector
This is a Transient Receptor Potential Cation Channel, Subfamily A, Member 1 plasmid from OriGene - 8 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(8 references)
Catalog No. ABIN3380471
Supplier Product No.: sc124028
$2,158.20
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human TRPA1 cDNA Clone in Mammalian Expression Vector (ABIN3380471)
Gene
TRPA1
(Transient Receptor Potential Cation Channel, Subfamily A, Member 1 (TRPA1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc124028
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TRPA1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Pinosylvin Inhibits TRPA1-Induced Calcium Influx In Vitro and TRPA1-Mediated Acute Paw Inflammation In Vivo." in: Basic & clinical pharmacology & toxicology, Vol. 118, Issue 3, pp. 238-42, (2016) (PubMed).
: "N-terminal tetrapeptide T/SPLH motifs contribute to multimodal activation of human TRPA1 channel." in: Scientific reports, Vol. 6, pp. 28700, (2016) (PubMed).
: "Structural modeling and patch-clamp analysis of pain-related mutation TRPA1-N855S reveal inter-subunit salt bridges stabilizing the channel open state." in: Neuropharmacology, Vol. 93, pp. 294-307, (2015) (PubMed).
: "Urate crystal induced inflammation and joint pain are reduced in transient receptor potential ankyrin 1 deficient mice--potential role for transient receptor potential ankyrin 1 in gout." in: PLoS ONE, Vol. 10, Issue 2, pp. e0117770, (2015) (PubMed).
: "Tramadol and its metabolite m1 selectively suppress transient receptor potential ankyrin 1 activity, but not transient receptor potential vanilloid 1 activity." in: Anesthesia and analgesia, Vol. 120, Issue 4, pp. 790-8, (2015) (PubMed).
: "C-terminal acidic cluster is involved in Ca2+-induced regulation of human transient receptor potential ankyrin 1 channel." in: The Journal of biological chemistry, Vol. 287, Issue 22, pp. 18067-77, (2012) (PubMed).
: "Novel menthol-derived cooling compounds activate primary and second-order trigeminal sensory neurons and modulate lingual thermosensitivity." in: Chemical senses, Vol. 36, Issue 7, pp. 649-58, (2011) (PubMed).
: "Artificial sweeteners and salts producing a metallic taste sensation activate TRPV1 receptors." in: American journal of physiology. Regulatory, integrative and comparative physiology, Vol. 293, Issue 2, pp. R626-34, (2007) (PubMed).
-
-
- TRPA1 (Transient Receptor Potential Cation Channel, Subfamily A, Member 1 (TRPA1))
-
Alternative Name
- TRPA1
-
Background
- The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined, however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_007332, NP_015628
Target
-
You are here:
