Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human UGT1A6 cDNA Clone in Mammalian Expression Vector

This is a UDP Glucuronosyltransferase 1 Family, Polypeptide A6 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2560 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380559
Supplier Product No.: sc119463
$736.56
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human UGT1A6 cDNA Clone in Mammalian Expression Vector (ABIN3380559)

Gene

UGT1A6 (UDP Glucuronosyltransferase 1 Family, Polypeptide A6 (UGT1A6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119463

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human UGT1A6 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2560 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Dates, Fahmi, Pyrek, Yao-Borengasser, Borowa-Mazgaj, Bratton, Kadlubar, Mackenzie, Haun, Radominska-Pandya: "Human UDP-Glucuronosyltransferases: Effects of altered expression in breast and pancreatic cancer cell lines." in: Cancer biology & therapy, Vol. 16, Issue 5, pp. 714-23, (2015) (PubMed).

  • Target

    UGT1A6 (UDP Glucuronosyltransferase 1 Family, Polypeptide A6 (UGT1A6))

    Alternative Name

    UGT1A6

    Background

    This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript. Its first exon contains both the 5' UTR and the 5' coding sequence, as is typical of the UGT1A genes.

    NCBI Accession

    NM_001072, NP_001063
You are here: