Human WNT5A cDNA Clone in Mammalian Expression Vector
Quick Overview for Human WNT5A cDNA Clone in Mammalian Expression Vector (ABIN3380667)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc126838
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human WNT5A is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 6000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Differential Wnt11 expression related to Wnt5a in high- and low-grade serous ovarian cancer: implications for migration, adhesion and survival." in: Asian Pacific journal of cancer prevention : APJCP, Vol. 15, Issue 3, pp. 1489-95, (2014) (PubMed).
: "β-Catenin-dependent pathway activation by both promiscuous "canonical" WNT3a-, and specific "noncanonical" WNT4- and WNT5a-FZD receptor combinations with strong differences in LRP5 and LRP6 ..." in: Cellular signalling, Vol. 26, Issue 2, pp. 260-7, (2013) (PubMed).
-
: "Differential Wnt11 expression related to Wnt5a in high- and low-grade serous ovarian cancer: implications for migration, adhesion and survival." in: Asian Pacific journal of cancer prevention : APJCP, Vol. 15, Issue 3, pp. 1489-95, (2014) (PubMed).
-
- WNT5A (Wingless-Type MMTV Integration Site Family, Member 5A (WNT5A))
-
Alternative Name
- WNT5A
-
Background
- The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
-
NCBI Accession
- NM_003392, NP_003383
Target
-