Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human WNT5A cDNA Clone in Mammalian Expression Vector

This is a Wingless-Type MMTV Integration Site Family, Member 5A plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 6000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380667
Supplier Product No.: sc126838
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human WNT5A cDNA Clone in Mammalian Expression Vector (ABIN3380667)

Gene

WNT5A (Wingless-Type MMTV Integration Site Family, Member 5A (WNT5A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc126838

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human WNT5A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Jannesari-Ladani, Hossein, Izadi-Mood: "Differential Wnt11 expression related to Wnt5a in high- and low-grade serous ovarian cancer: implications for migration, adhesion and survival." in: Asian Pacific journal of cancer prevention : APJCP, Vol. 15, Issue 3, pp. 1489-95, (2014) (PubMed).

    Ring, Neth, Weber, Steffens, Faussner et al.: "β-Catenin-dependent pathway activation by both promiscuous "canonical" WNT3a-, and specific "noncanonical" WNT4- and WNT5a-FZD receptor combinations with strong differences in LRP5 and LRP6 ..." in: Cellular signalling, Vol. 26, Issue 2, pp. 260-7, (2013) (PubMed).

  • Target

    WNT5A (Wingless-Type MMTV Integration Site Family, Member 5A (WNT5A))

    Alternative Name

    WNT5A

    Background

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_003392, NP_003383
You are here: