Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human AFF1 cDNA Clone in Mammalian Expression Vector

This is a AF4/FMR2 Family, Member 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380879
Supplier Product No.: sc309949
$2,507.67
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human AFF1 cDNA Clone in Mammalian Expression Vector (ABIN3380879)

Gene

AF4 (AFF1) (AF4/FMR2 Family, Member 1 (AFF1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc309949

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human AFF1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    AF4 (AFF1) (AF4/FMR2 Family, Member 1 (AFF1))

    Alternative Name

    AFF1

    Background

    This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. The protein functions as a regulator of RNA polymerase II-mediated transcription through elongation and chromatin remodeling functions. Through RNA interference screens, this gene has been shown to promote the expression of CD133, a plasma membrane glycoprotein required for leukemia cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (2) contains a distinct 5' UTR and 5' coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter, distinct N-terminus but the same C-terminus, compared to isoform 1.

    NCBI Accession

    NM_005935, NP_005926
You are here: