Human BCL2 cDNA Clone in Mammalian Expression Vector
This is a B-Cell CLL/lymphoma 2 plasmid from OriGene - 7 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3050 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(7 references)
Catalog No. ABIN3380932
Supplier Product No.: sc125546
$445.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human BCL2 cDNA Clone in Mammalian Expression Vector (ABIN3380932)
Gene
Bcl-2 (BCL2)
(B-Cell CLL/lymphoma 2 (BCL2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc125546
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human BCL2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3050 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity." in: Biochemical and biophysical research communications, Vol. 477, Issue 4, pp. 607-13, (2016) (PubMed).
: "Apoptosis as the focus of an authentic research experience in a cell physiology laboratory." in: Advances in physiology education, Vol. 40, Issue 2, pp. 257-64, (2016) (PubMed).
: "Messenger RNA-based therapeutics for the treatment of apoptosis-associated diseases." in: Scientific reports, Vol. 5, pp. 15810, (2015) (PubMed).
: "Sorafenib sensitizes (-)-gossypol-induced growth suppression in androgen-independent prostate cancer cells via Mcl-1 inhibition and Bak activation." in: Molecular cancer therapeutics, Vol. 11, Issue 2, pp. 416-26, (2012) (PubMed).
: "BCL2 inhibits cell adhesion, spreading, and motility by enhancing actin polymerization." in: Cell research, Vol. 20, Issue 4, pp. 458-69, (2010) (PubMed).
: "A natural BH3 mimetic induces autophagy in apoptosis-resistant prostate cancer via modulating Bcl-2-Beclin1 interaction at endoplasmic reticulum." in: Cell death and differentiation, Vol. 18, Issue 1, pp. 60-71, (2010) (PubMed).
: "Mitogen-activated protein kinase inhibition induces translocation of Bmf to promote apoptosis in melanoma." in: Cancer research, Vol. 69, Issue 5, pp. 1985-94, (2009) (PubMed).
-
: "Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity." in: Biochemical and biophysical research communications, Vol. 477, Issue 4, pp. 607-13, (2016) (PubMed).
-
- Bcl-2 (BCL2) (B-Cell CLL/lymphoma 2 (BCL2))
-
Alternative Name
- BCL2
-
Background
- This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (alpha) represents the longer transcript and encodes the longer isoform (alpha).
-
NCBI Accession
- NM_000633, NP_000624
Target
-
You are here:
