Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BCL2L11 cDNA Clone in Mammalian Expression Vector

This is a BCL2-Like 11 (Apoptosis Facilitator) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380934
Supplier Product No.: sc306048
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human BCL2L11 cDNA Clone in Mammalian Expression Vector (ABIN3380934)

Gene

BIM (BCL2L11) (BCL2-Like 11 (Apoptosis Facilitator) (BCL2L11))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc306048

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BCL2L11 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Tay, Jin, Tseng, Jiang, Ye, Thorne, Liu, Guo, Verrills, Hersey, Zhang: "Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress." in: Cell death & disease, Vol. 3, pp. e337, (2012) (PubMed).

    Leung, Li, Sun, Chan, Ooi, Chiu: "Activation of the JNK pathway promotes phosphorylation and degradation of BimEL--a novel mechanism of chemoresistance in T-cell acute lymphoblastic leukemia." in: Carcinogenesis, Vol. 29, Issue 3, pp. 544-51, (2008) (PubMed).

  • Target

    BIM (BCL2L11) (BCL2-Like 11 (Apoptosis Facilitator) (BCL2L11))

    Alternative Name

    BCL2L11

    Background

    The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (1, also known as BimEL) encodes the longest isoform (1).

    NCBI Accession

    NM_138621, NP_619527
You are here: