Human BCL2L11 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human BCL2L11 cDNA Clone in Mammalian Expression Vector (ABIN3380934)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc306048
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human BCL2L11 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress." in: Cell death & disease, Vol. 3, pp. e337, (2012) (PubMed).
: "Activation of the JNK pathway promotes phosphorylation and degradation of BimEL--a novel mechanism of chemoresistance in T-cell acute lymphoblastic leukemia." in: Carcinogenesis, Vol. 29, Issue 3, pp. 544-51, (2008) (PubMed).
-
: "Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress." in: Cell death & disease, Vol. 3, pp. e337, (2012) (PubMed).
-
- BIM (BCL2L11) (BCL2-Like 11 (Apoptosis Facilitator) (BCL2L11))
-
Alternative Name
- BCL2L11
-
Background
- The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (1, also known as BimEL) encodes the longest isoform (1).
-
NCBI Accession
- NM_138621, NP_619527
Target
-