Human BIRC5 cDNA Clone in Mammalian Expression Vector
This is a Baculoviral IAP Repeat-Containing 5 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2700 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3380946
Supplier Product No.: sc119405
$148.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human BIRC5 cDNA Clone in Mammalian Expression Vector (ABIN3380946)
Gene
Survivin (BIRC5)
(Baculoviral IAP Repeat-Containing 5 (BIRC5))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119405
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human BIRC5 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2700 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cellular inhibitor of apoptosis protein 1 (cIAP1) stability contributes to YM155 resistance in human gastric cancer cells." in: The Journal of biological chemistry, Vol. 290, Issue 16, pp. 9974-85, (2015) (PubMed).
: "Synergistic Induction of Erlotinib-Mediated Apoptosis by Resveratrol in Human Non-Small-Cell Lung Cancer Cells by Down-Regulating Survivin and Up-Regulating PUMA." in: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, Vol. 35, Issue 6, pp. 2255-71, (2015) (PubMed).
: "Survivin transcript variant 2 drives angiogenesis and malignant progression in proneural gliomas." in: Neuro-oncology, Vol. 16, Issue 9, pp. 1220-8, (2014) (PubMed).
: "Sorafenib overcomes TRAIL resistance of hepatocellular carcinoma cells through the inhibition of STAT3." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 16, Issue 21, pp. 5189-99, (2010) (PubMed).
-
: "Cellular inhibitor of apoptosis protein 1 (cIAP1) stability contributes to YM155 resistance in human gastric cancer cells." in: The Journal of biological chemistry, Vol. 290, Issue 16, pp. 9974-85, (2015) (PubMed).
-
- Survivin (BIRC5) (Baculoviral IAP Repeat-Containing 5 (BIRC5))
-
Alternative Name
- BIRC5
-
Background
- This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011].Transcript Variant: This variant (1) represents the most frequently occurring transcript and it encodes isoform 1.
-
NCBI Accession
- NM_001168, NP_001159
Target
-
You are here:
