Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BIRC5 cDNA Clone in Mammalian Expression Vector

This is a Baculoviral IAP Repeat-Containing 5 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380947
Supplier Product No.: sc301617
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human BIRC5 cDNA Clone in Mammalian Expression Vector (ABIN3380947)

Gene

Survivin (BIRC5) (Baculoviral IAP Repeat-Containing 5 (BIRC5))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc301617

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BIRC5 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Doucette, Latha, Yang, Fuller, Rao, Rao: "Survivin transcript variant 2 drives angiogenesis and malignant progression in proneural gliomas." in: Neuro-oncology, Vol. 16, Issue 9, pp. 1220-8, (2014) (PubMed).

    Yoshida, Zhang, Rivera Rosado, Chen, Khan, Moon, Zhang: "Blockade of Rac1 activity induces G1 cell cycle arrest or apoptosis in breast cancer cells through downregulation of cyclin D1, survivin, and X-linked inhibitor of apoptosis protein." in: Molecular cancer therapeutics, Vol. 9, Issue 6, pp. 1657-68, (2010) (PubMed).

  • Target

    Survivin (BIRC5) (Baculoviral IAP Repeat-Containing 5 (BIRC5))

    Alternative Name

    BIRC5

    Background

    This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011].Transcript Variant: This variant (2), also known as survivin-deltaEx3, lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus when it is compared to isoform 1.

    NCBI Accession

    NM_001012270, NP_001012270
You are here: