Human CCR3 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CCR3 cDNA Clone in Mammalian Expression Vector (ABIN3380999)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118980
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CCR3 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The lupane-type triterpene 30-oxo-calenduladiol is a CCR5 antagonist with anti-HIV-1 and anti-chemotactic activities." in: The Journal of biological chemistry, Vol. 284, Issue 24, pp. 16609-20, (2009) (PubMed).
: "Molecular interaction of a potent nonpeptide agonist with the chemokine receptor CCR8." in: Molecular pharmacology, Vol. 72, Issue 2, pp. 327-40, (2007) (PubMed).
-
: "The lupane-type triterpene 30-oxo-calenduladiol is a CCR5 antagonist with anti-HIV-1 and anti-chemotactic activities." in: The Journal of biological chemistry, Vol. 284, Issue 24, pp. 16609-20, (2009) (PubMed).
-
- CCR3 (Chemokine (C-C Motif) Receptor 3 (CCR3))
-
Alternative Name
- CCR3
-
Background
- The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009].Transcript Variant: This variant (1) represents the longest transcript. It encodes the same isoform (1) as variant 2.
-
NCBI Accession
- NM_001837, NP_001828
Target
-