Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CCR3 cDNA Clone in Mammalian Expression Vector

This is a Chemokine (C-C Motif) Receptor 3 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3380999
Supplier Product No.: sc118980
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CCR3 cDNA Clone in Mammalian Expression Vector (ABIN3380999)

Gene

CCR3 (Chemokine (C-C Motif) Receptor 3 (CCR3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118980

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CCR3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Barroso-González, El Jaber-Vazdekis, García-Expósito, Machado, Zárate, Ravelo, Estévez-Braun, Valenzuela-Fernández: "The lupane-type triterpene 30-oxo-calenduladiol is a CCR5 antagonist with anti-HIV-1 and anti-chemotactic activities." in: The Journal of biological chemistry, Vol. 284, Issue 24, pp. 16609-20, (2009) (PubMed).

    Jensen, Nygaard, Thiele, Elder, Zhu, Kolbeck, Ghosh, Schwartz, Rosenkilde: "Molecular interaction of a potent nonpeptide agonist with the chemokine receptor CCR8." in: Molecular pharmacology, Vol. 72, Issue 2, pp. 327-40, (2007) (PubMed).

  • Target

    CCR3 (Chemokine (C-C Motif) Receptor 3 (CCR3))

    Alternative Name

    CCR3

    Background

    The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009].Transcript Variant: This variant (1) represents the longest transcript. It encodes the same isoform (1) as variant 2.

    NCBI Accession

    NM_001837, NP_001828
You are here: