Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CYP26B1 cDNA Clone in Mammalian Expression Vector

This is a Cytochrome P450, Family 26, Subfamily B, Polypeptide 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381076
Supplier Product No.: sc120799
$708.84
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CYP26B1 cDNA Clone in Mammalian Expression Vector (ABIN3381076)

Gene

CYP26B1 (Cytochrome P450, Family 26, Subfamily B, Polypeptide 1 (CYP26B1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc120799

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CYP26B1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Foti, Isoherranen, Zelter, Dickmann, Buttrick, Diaz, Douguet: "Identification of Tazarotenic Acid as the First Xenobiotic Substrate of Human Retinoic Acid Hydroxylase CYP26A1 and CYP26B1." in: The Journal of pharmacology and experimental therapeutics, Vol. 357, Issue 2, pp. 281-92, (2016) (PubMed).

    Tay, Dickmann, Dixit, Isoherranen: "A comparison of the roles of peroxisome proliferator-activated receptor and retinoic acid receptor on CYP26 regulation." in: Molecular pharmacology, Vol. 77, Issue 2, pp. 218-27, (2010) (PubMed).

  • Target

    CYP26B1 (Cytochrome P450, Family 26, Subfamily B, Polypeptide 1 (CYP26B1))

    Alternative Name

    CYP26B1

    Background

    This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_019885, NP_063938
You are here: