Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human DRD3 cDNA Clone in Mammalian Expression Vector

This is a Dopamine Receptor D3 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381113
Supplier Product No.: sc124083
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human DRD3 cDNA Clone in Mammalian Expression Vector (ABIN3381113)

Gene

DRD3 (Dopamine Receptor D3 (DRD3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc124083

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human DRD3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Micheli, Bernardelli, Bianchi, Braggio, Castelletti, Cavallini, Cavanni, Cremonesi, Dal Cin, Feriani, Oliosi, Semeraro, Tarsi, Tomelleri, Wong, Visentini, Zonzini, Heidbreder: "1,2,4-Triazolyl octahydropyrrolo[2,3-b]pyrroles: A new series of potent and selective dopamine D3 receptor antagonists." in: Bioorganic & medicinal chemistry, Vol. 24, Issue 8, pp. 1619-36, (2016) (PubMed).

    Micheli, Bacchi, Braggio, Castelletti, Cavallini, Cavanni, Cremonesi, Dal Cin, Feriani, Gehanne, Kajbaf, Marchió, Nola, Oliosi, Pellacani, Perdonà, Sava, Semeraro, Tarsi, Tomelleri, Wong, Visentini et al.: "1,2,4-Triazolyl 5-Azaspiro[2.4]heptanes: Lead Identification and Early Lead Optimization of a New Series of Potent and Selective Dopamine D3 Receptor Antagonists. ..." in: Journal of medicinal chemistry, Vol. 59, Issue 18, pp. 8549-76, (2016) (PubMed).

  • Target

    DRD3 (Dopamine Receptor D3 (DRD3))

    Alternative Name

    DRD3

    Background

    This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008].Transcript Variant: This variant (a) represents the predominant transcript and encodes the longer isoform (a). Variants a, f and g encode the same isoform (a).

    NCBI Accession

    NM_000796, NP_000787
You are here: