Human ErbB2/Her2 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ErbB2/Her2 cDNA Clone in Mammalian Expression Vector (ABIN3381157)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc128161
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ERBB2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Antibody response to HER2 extracellular domain and subdomains in mouse following DNA immunization." in: Tumour biology, Vol. 37, Issue 1, pp. 1217-27, (2016) (PubMed).
: "Time-resolved fluorescence resonance energy transfer (TR-FRET) to analyze the disruption of EGFR/HER2 dimers: a new method to evaluate the efficiency of targeted therapy using monoclonal antibodies." in: The Journal of biological chemistry, Vol. 286, Issue 13, pp. 11337-45, (2011) (PubMed).
: "Matrix metalloproteinase-1 expression can be upregulated through mitogen-activated protein kinase pathway under the influence of human epidermal growth factor receptor 2 synergized with estrogen ..." in: Molecular cancer research : MCR, Vol. 8, Issue 7, pp. 1037-47, (2010) (PubMed).
-
-
- ErbB2/Her2 (Receptor tyrosine-protein kinase erbB-2 (ErbB2/Her2))
-
Alternative Name
- ERBB2
-
Background
- This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) encodes the longest isoform (a).
-
NCBI Accession
- NM_004448, NP_004439
Target
-