Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ESR2 cDNA Clone in Mammalian Expression Vector

This is a Estrogen Receptor 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381164
Supplier Product No.: sc119216
$733.59
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ESR2 cDNA Clone in Mammalian Expression Vector (ABIN3381164)

Gene

ESR2 (Estrogen Receptor 2 (ESR2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119216

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ESR2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Monsivais, Dyson, Yin, Coon, Navarro, Feng, Malpani, Ono, Ercan, Wei, Pavone, Su, Bulun: "ERβ- and prostaglandin E2-regulated pathways integrate cell proliferation via Ras-like and estrogen-regulated growth inhibitor in endometriosis." in: Molecular endocrinology (Baltimore, Md.), Vol. 28, Issue 8, pp. 1304-15, (2014) (PubMed).

    Hiroi, Lacagnina, Hinds, Carbone, Uht, Handa: "The androgen metabolite, 5α-androstane-3β,17β-diol (3β-diol), activates the oxytocin promoter through an estrogen receptor-β pathway." in: Endocrinology, Vol. 154, Issue 5, pp. 1802-12, (2013) (PubMed).

  • Target

    ESR2 (Estrogen Receptor 2 (ESR2))

    Alternative Name

    ESR2

    Background

    This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (a, also known as 1) encodes the longest isoform (1).

    NCBI Accession

    NM_001437, NP_001428
You are here: