Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FCGR3A cDNA Clone in Mammalian Expression Vector

This is a Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381187
Supplier Product No.: sc124061
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FCGR3A cDNA Clone in Mammalian Expression Vector (ABIN3381187)

Gene

FCGR3A (Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) (FCGR3A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc124061

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FCGR3A is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kudo, Imai, Lorenzini, Kamiya, Kono, Davidoff, Chng, Campana: "T lymphocytes expressing a CD16 signaling receptor exert antibody-dependent cancer cell killing." in: Cancer research, Vol. 74, Issue 1, pp. 93-103, (2014) (PubMed).

    Tada, Ishii-Watabe, Suzuki, Kawasaki: "Development of a cell-based assay measuring the activation of FcγRIIa for the characterization of therapeutic monoclonal antibodies." in: PLoS ONE, Vol. 9, Issue 4, pp. e95787, (2014) (PubMed).

    Shalova, Kajiji, Lim, Gómez-Piña, Fernández-Ruíz, Arnalich, Iau, López-Collazo, Wong, Biswas: "CD16 regulates TRIF-dependent TLR4 response in human monocytes and their subsets." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 188, Issue 8, pp. 3584-93, (2012) (PubMed).

    Trotta, Dal Col, Yu, Ciarlariello, Thomas, Zhang, Allard, Wei, Mao, Byrd, Perrotti, Caligiuri: "TGF-beta utilizes SMAD3 to inhibit CD16-mediated IFN-gamma production and antibody-dependent cellular cytotoxicity in human NK cells." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 181, Issue 6, pp. 3784-92, (2008) (PubMed).

  • Target

    FCGR3A (Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) (FCGR3A))

    Alternative Name

    FCGR3A

    Background

    This gene encodes a receptor for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other other antibody-dependent responses. This gene (FCGR3A) is highly similar to another nearby gene (FCGR3B) located on chromosome 1. The receptor encoded by this gene is expressed on natural killer (NK) cells as an integral membrane glycoprotein anchored through a transmembrane peptide, whereas FCGR3B is expressed on polymorphonuclear neutrophils (PMN) where the receptor is anchored through a phosphatidylinositol (PI) linkage. Mutations in this gene have been linked to susceptibility to recurrent viral infections, susceptibility to systemic lupus erythematosus, and alloimmune neonatal neutropenia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).

    NCBI Accession

    NM_000569, NP_000560
You are here: