Human FCGR3A cDNA Clone in Mammalian Expression Vector
This is a Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3381187
Supplier Product No.: sc124061
$445.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human FCGR3A cDNA Clone in Mammalian Expression Vector (ABIN3381187)
Gene
FCGR3A
(Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) (FCGR3A))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc124061
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human FCGR3A is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "T lymphocytes expressing a CD16 signaling receptor exert antibody-dependent cancer cell killing." in: Cancer research, Vol. 74, Issue 1, pp. 93-103, (2014) (PubMed).
: "Development of a cell-based assay measuring the activation of FcγRIIa for the characterization of therapeutic monoclonal antibodies." in: PLoS ONE, Vol. 9, Issue 4, pp. e95787, (2014) (PubMed).
: "CD16 regulates TRIF-dependent TLR4 response in human monocytes and their subsets." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 188, Issue 8, pp. 3584-93, (2012) (PubMed).
: "TGF-beta utilizes SMAD3 to inhibit CD16-mediated IFN-gamma production and antibody-dependent cellular cytotoxicity in human NK cells." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 181, Issue 6, pp. 3784-92, (2008) (PubMed).
-
-
- FCGR3A (Fc Fragment of IgG, Low Affinity IIIa, Receptor (CD16a) (FCGR3A))
-
Alternative Name
- FCGR3A
-
Background
- This gene encodes a receptor for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other other antibody-dependent responses. This gene (FCGR3A) is highly similar to another nearby gene (FCGR3B) located on chromosome 1. The receptor encoded by this gene is expressed on natural killer (NK) cells as an integral membrane glycoprotein anchored through a transmembrane peptide, whereas FCGR3B is expressed on polymorphonuclear neutrophils (PMN) where the receptor is anchored through a phosphatidylinositol (PI) linkage. Mutations in this gene have been linked to susceptibility to recurrent viral infections, susceptibility to systemic lupus erythematosus, and alloimmune neonatal neutropenia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
-
NCBI Accession
- NM_000569, NP_000560
Target
-
You are here:
