Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FGFR3 cDNA Clone in Mammalian Expression Vector

This is a Fibroblast Growth Factor Receptor 3 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381203
Supplier Product No.: sc327221
$1,099.89
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FGFR3 cDNA Clone in Mammalian Expression Vector (ABIN3381203)

Gene

FGFR3 (Fibroblast Growth Factor Receptor 3 (FGFR3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327221

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FGFR3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    FGFR3 (Fibroblast Growth Factor Receptor 3 (FGFR3))

    Alternative Name

    FGFR3

    Background

    This gene encodes a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Jul 2009].Transcript Variant: This variant (3), also known as isoform IIIb, contains alternatively spliced exon 8 but lacks exon 9, compared to variant 1. The resulting protein (isoform 3) has the IIIb-type C-terminal half of the IgIII domain and is longer when it is compared to isoform 1.

    NCBI Accession

    NM_001163213, NP_001156685
You are here: