Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GATA4 cDNA Clone in Mammalian Expression Vector

This is a GATA Binding Protein 4 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381231
Supplier Product No.: sc124037
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GATA4 cDNA Clone in Mammalian Expression Vector (ABIN3381231)

Gene

GATA4 (GATA Binding Protein 4 (GATA4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc124037

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GATA4 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Xia, Gong, Zhang, Cai, Zeng: "Loss of GATA5 expression due to gene promoter methylation induces growth and colony formation of hepatocellular carcinoma cells." in: Oncology letters, Vol. 11, Issue 1, pp. 861-869, (2016) (PubMed).

    Simeonov, Uppal: "Direct reprogramming of human fibroblasts to hepatocyte-like cells by synthetic modified mRNAs." in: PLoS ONE, Vol. 9, Issue 6, pp. e100134, (2014) (PubMed).

    Agnihotri, Wolf, Munoz, Smith, Gajadhar, Restrepo, Clarke, Fuller, Kesari, Dirks, McGlade, Stanford, Aldape, Mischel, Hawkins, Guha: "A GATA4-regulated tumor suppressor network represses formation of malignant human astrocytomas." in: The Journal of experimental medicine, Vol. 208, Issue 4, pp. 689-702, (2011) (PubMed).

    Agnihotri, Wolf, Picard, Hawkins, Guha: "GATA4 is a regulator of astrocyte cell proliferation and apoptosis in the human and murine central nervous system." in: Oncogene, Vol. 28, Issue 34, pp. 3033-46, (2009) (PubMed).

  • Target

    GATA4 (GATA Binding Protein 4 (GATA4))

    Alternative Name

    GATA4

    Background

    This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015].

    NCBI Accession

    NM_002052, NP_002043
You are here: