Human GHRL cDNA Clone in Mammalian Expression Vector
This is a Ghrelin plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: not_set. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3381240
Supplier Product No.: sc114299
$148.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human GHRL cDNA Clone in Mammalian Expression Vector (ABIN3381240)
Gene
Ghrelin (GHRL)
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc114299
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human GHRL is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Ghrelin octanoylation mediated by an orphan lipid transferase." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 17, pp. 6320-5, (2008) (PubMed).
-
: "Ghrelin octanoylation mediated by an orphan lipid transferase." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 17, pp. 6320-5, (2008) (PubMed).
-
- Ghrelin (GHRL)
-
Alternative Name
- GHRL
-
Background
- This gene encodes the ghrelin-obestatin preproprotein that is cleaved to yield two peptides, ghrelin and obestatin. Ghrelin is a powerful appetite stimulant and plays an important role in energy homeostasis. Its secretion is initiated when the stomach is empty, whereupon it binds to the growth hormone secretagogue receptor in the hypothalamus which results in the secretion of growth hormone (somatotropin). Ghrelin is thought to regulate multiple activities, including hunger, reward perception via the mesolimbic pathway, gastric acid secretion, gastrointestinal motility, and pancreatic glucose-stimulated insulin secretion. It was initially proposed that obestatin plays an opposing role to ghrelin by promoting satiety and thus decreasing food intake, but this action is still debated. Recent reports suggest multiple metabolic roles for obestatin, including regulating adipocyte function and glucose metabolism. Alternative splicing results in multiple transcript variants. In addition, antisense transcripts for this gene have been identified and may potentially regulate ghrelin-obestatin preproprotein expression. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). This isoform (1) contains the ligands ghrelin-28 and obestatin. Variants 1, 8, 9, 11 and 12 encode the same protein.
-
NCBI Accession
- NM_016362, NP_057446
Target
-
You are here:
