Human GLI2 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human GLI2 cDNA Clone in Mammalian Expression Vector (ABIN3381248)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc303613
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human GLI2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 6000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Vitamin D3 triggers antitumor activity through targeting hedgehog signaling in human renal cell carcinoma." in: Carcinogenesis, Vol. 33, Issue 11, pp. 2084-93, (2012) (PubMed).
-
-
- GLI2 (GLI Family Zinc Finger 2 (GLI2))
-
Alternative Name
- GLI2
-
Background
- This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (4) lacks an internal 51 nt, but maintains the same reading frame as variant 1 until the second exclusion. This exclusion occurs 1231 nt from the 3' end of the coding region and causes a frameshift. Thus, the resulting isoform, delta, has a different carboxyl-terminus and premature truncation compared to isoform alpha, encoded by transcript variant 1.
-
NCBI Accession
- NM_005270, NP_005261
Target
-