Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GNA11 cDNA Clone in Mammalian Expression Vector

This is a Guanine Nucleotide Binding Protein (G Protein), alpha 11 (Gq Class) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381250
Supplier Product No.: sc303115
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GNA11 cDNA Clone in Mammalian Expression Vector (ABIN3381250)

Gene

GNA11 (Guanine Nucleotide Binding Protein (G Protein), alpha 11 (Gq Class) (GNA11))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc303115

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GNA11 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Thomas, Zeng, Rivière, OShaughnessy, Al-Olabi, St-Onge, Atherton, Aubert, Bagazgoitia, Barbarot, Bourrat, Chiaverini, Chong, Duffourd, Glover, Groesser, Hadj-Rabia, Hamm, Happle, Mushtaq, Lacour et al.: "Mosaic Activating Mutations in GNA11 and GNAQ Are Associated with Phakomatosis Pigmentovascularis and Extensive Dermal Melanocytosis. ..." in: The Journal of investigative dermatology, Vol. 136, Issue 4, pp. 770-8, (2016) (PubMed).

    Giannotta, Ruggiero, Grossi, Cancino, Capitani, Pulvirenti, Consoli, Geraci, Fanelli, Luini, Sallese: "The KDEL receptor couples to Gαq/11 to activate Src kinases and regulate transport through the Golgi." in: The EMBO journal, Vol. 31, Issue 13, pp. 2869-81, (2012) (PubMed).

  • Target

    GNA11 (Guanine Nucleotide Binding Protein (G Protein), alpha 11 (Gq Class) (GNA11))

    Alternative Name

    GNA11

    Background

    The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013].

    NCBI Accession

    NM_002067, NP_002058
You are here: