Human HGF cDNA Clone in Mammalian Expression Vector
Quick Overview for Human HGF cDNA Clone in Mammalian Expression Vector (ABIN3381315)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc127905
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HGF is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 5000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Hepatocyte growth factor-modified adipose tissue-derived stem cells improve erectile function in streptozotocin-induced diabetic rats." in: Growth factors (Chur, Switzerland), Vol. 33, Issue 4, pp. 282-9, (2015) (PubMed).
: "Autocrine activation of the MET receptor tyrosine kinase in acute myeloid leukemia." in: Nature medicine, Vol. 18, Issue 7, pp. 1118-22, (2012) (PubMed).
-
: "Hepatocyte growth factor-modified adipose tissue-derived stem cells improve erectile function in streptozotocin-induced diabetic rats." in: Growth factors (Chur, Switzerland), Vol. 33, Issue 4, pp. 282-9, (2015) (PubMed).
-
- HGF (Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF))
-
Alternative Name
- HGF
-
Background
- This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015].Transcript Variant: This variant (1) encodes the longest isoform (1). To date, experimental evidence for cleavage of the proprotein into two mature chains has been shown only for isoform 1.
-
NCBI Accession
- NM_000601, NP_000592
Target
-