Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HGF cDNA Clone in Mammalian Expression Vector

This is a Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 5000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381315
Supplier Product No.: sc127905
$990.99
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human HGF cDNA Clone in Mammalian Expression Vector (ABIN3381315)

Gene

HGF (Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc127905

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HGF is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    5000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Liu, Peng, Jia, Fang, Li, Zhong: "Hepatocyte growth factor-modified adipose tissue-derived stem cells improve erectile function in streptozotocin-induced diabetic rats." in: Growth factors (Chur, Switzerland), Vol. 33, Issue 4, pp. 282-9, (2015) (PubMed).

    Kentsis, Reed, Rice, Sanda, Rodig, Tholouli, Christie, Valk, Delwel, Ngo, Kutok, Dahlberg, Moreau, Byers, Christensen, Vande Woude, Licht, Kung, Staudt, Look: "Autocrine activation of the MET receptor tyrosine kinase in acute myeloid leukemia." in: Nature medicine, Vol. 18, Issue 7, pp. 1118-22, (2012) (PubMed).

  • Target

    HGF (Hepatocyte Growth Factor (Hepapoietin A, Scatter Factor) (HGF))

    Alternative Name

    HGF

    Background

    This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015].Transcript Variant: This variant (1) encodes the longest isoform (1). To date, experimental evidence for cleavage of the proprotein into two mature chains has been shown only for isoform 1.

    NCBI Accession

    NM_000601, NP_000592
You are here: