Human KCNQ1 cDNA Clone in Mammalian Expression Vector
This is a Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3381402
Supplier Product No.: sc300026
$920.70
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human KCNQ1 cDNA Clone in Mammalian Expression Vector (ABIN3381402)
Gene
KCNQ1
(Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc300026
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human KCNQ1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Single-channel basis for the slow activation of the repolarizing cardiac potassium current, I(Ks)." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 11, pp. E996-1005, (2013) (PubMed).
: "Mechanistic basis for LQT1 caused by S3 mutations in the KCNQ1 subunit of IKs." in: The Journal of general physiology, Vol. 135, Issue 5, pp. 433-48, (2010) (PubMed).
-
: "Single-channel basis for the slow activation of the repolarizing cardiac potassium current, I(Ks)." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 11, pp. E996-1005, (2013) (PubMed).
-
- KCNQ1 (Potassium Voltage-Gated Channel, KQT-Like Subfamily, Member 1 (KCNQ1))
-
Alternative Name
- KCNQ1
-
Background
- This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011].Transcript Variant: This variant (1) encodes the longer isoform (1).
-
NCBI Accession
- NM_000218, NP_000209
Target
-
You are here:
