Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PCSK5 cDNA Clone in Mammalian Expression Vector

This is a Proprotein Convertase Subtilisin/kexin Type 5 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381625
Supplier Product No.: sc310051
$828.63
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PCSK5 cDNA Clone in Mammalian Expression Vector (ABIN3381625)

Gene

PCSK5 (Proprotein Convertase Subtilisin/kexin Type 5 (PCSK5))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc310051

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PCSK5 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PCSK5 (Proprotein Convertase Subtilisin/kexin Type 5 (PCSK5))

    Alternative Name

    PCSK5

    Background

    This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER. It then sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. This encoded protein is widely expressed and one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It mediates posttranslational endoproteolytic processing for several integrin alpha subunits and is thought to process prorenin, pro-membrane type-1 matrix metalloproteinase and HIV-1 glycoprotein gp160. Alternative splicing results in multiple transcript variants, some of which encode distinct isoforms, including a protease packaged into dense core granules (PC5A) and a type 1 membrane bound protease (PC5B). [provided by RefSeq, May 2014].Transcript Variant: This variant (2) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (PC5A, alternatively referred to as the short form) has a substantially shorter and distinct C-terminus, compared to isoform PC5B.

    NCBI Accession

    NM_006200, NP_006191
You are here: