Human PRKACA cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PRKACA cDNA Clone in Mammalian Expression Vector (ABIN3381677)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc125607
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PRKACA is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1800 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Prostaglandin (PG)D(2) and 15-deoxy-Delta(12,14)-PGJ(2), but not PGE(2), mediate shear-induced chondrocyte apoptosis via protein kinase A-dependent regulation of polo-like kinases." in: Cell death and differentiation, Vol. 17, Issue 8, pp. 1325-34, (2010) (PubMed).
: "Protein kinase A phosphorylation activates Vpr-induced cell cycle arrest during human immunodeficiency virus type 1 infection." in: Journal of virology, Vol. 84, Issue 13, pp. 6410-24, (2010) (PubMed).
-
-
- PRKACA (Protein Kinase A, alpha (PRKACA))
-
Alternative Name
- PRKACA
-
Background
- This gene encodes one of the catalytic subunits of protein kinase A, which exists as a tetrameric holoenzyme with two regulatory subunits and two catalytic subunits, in its inactive form. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. cAMP-dependent phosphorylation of proteins by protein kinase A is important to many cellular processes, including differentiation, proliferation, and apoptosis. Constitutive activation of this gene caused either by somatic mutations, or genomic duplications of regions that include this gene, have been associated with hyperplasias and adenomas of the adrenal cortex and are linked to corticotropin-independent Cushing's syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. Tissue-specific isoforms that differ at the N-terminus have been described, and these isoforms may differ in the post-translational modifications that occur at the N-terminus of some isoforms. [provided by RefSeq, Jan 2015].Transcript Variant: This variant (1) encodes Calpha1 (PMID:21812984).
-
NCBI Accession
- NM_002730, NP_002721
Target
-