Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRKACA cDNA Clone in Mammalian Expression Vector

This is a Protein Kinase A, alpha plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381677
Supplier Product No.: sc125607
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRKACA cDNA Clone in Mammalian Expression Vector (ABIN3381677)

Gene

PRKACA (Protein Kinase A, alpha (PRKACA))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125607

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRKACA is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Zhu, Wang, Kontrogianni-Konstantopoulos, Konstantopoulos: "Prostaglandin (PG)D(2) and 15-deoxy-Delta(12,14)-PGJ(2), but not PGE(2), mediate shear-induced chondrocyte apoptosis via protein kinase A-dependent regulation of polo-like kinases." in: Cell death and differentiation, Vol. 17, Issue 8, pp. 1325-34, (2010) (PubMed).

    Barnitz, Wan, Tripuraneni, Bolton, Lenardo: "Protein kinase A phosphorylation activates Vpr-induced cell cycle arrest during human immunodeficiency virus type 1 infection." in: Journal of virology, Vol. 84, Issue 13, pp. 6410-24, (2010) (PubMed).

  • Target

    PRKACA (Protein Kinase A, alpha (PRKACA))

    Alternative Name

    PRKACA

    Background

    This gene encodes one of the catalytic subunits of protein kinase A, which exists as a tetrameric holoenzyme with two regulatory subunits and two catalytic subunits, in its inactive form. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. cAMP-dependent phosphorylation of proteins by protein kinase A is important to many cellular processes, including differentiation, proliferation, and apoptosis. Constitutive activation of this gene caused either by somatic mutations, or genomic duplications of regions that include this gene, have been associated with hyperplasias and adenomas of the adrenal cortex and are linked to corticotropin-independent Cushing's syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. Tissue-specific isoforms that differ at the N-terminus have been described, and these isoforms may differ in the post-translational modifications that occur at the N-terminus of some isoforms. [provided by RefSeq, Jan 2015].Transcript Variant: This variant (1) encodes Calpha1 (PMID:21812984).

    NCBI Accession

    NM_002730, NP_002721
You are here: