Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRKG1 cDNA Clone in Mammalian Expression Vector

This is a Protein Kinase, CGMP-Dependent, Type I plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381686
Supplier Product No.: sc116252
$622.71
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRKG1 cDNA Clone in Mammalian Expression Vector (ABIN3381686)

Gene

PRKG1 (Protein Kinase, CGMP-Dependent, Type I (PRKG1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116252

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRKG1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PRKG1 (Protein Kinase, CGMP-Dependent, Type I (PRKG1))

    Alternative Name

    PRKG1

    Background

    Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (2) uses an alternate exon at its 5' end which result in the use of a distinct translation initiation site, compared to variant 1. This difference results in an isoform (2, also known as beta or 1beta) with a longer and distinct N-terminus, compared to isoform 1.

    NCBI Accession

    NM_006258, NP_006249
You are here: