Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PTPRD cDNA Clone in Mammalian Expression Vector

This is a Protein tyrosine Phosphatase, Receptor Type, D plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 7000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381714
Supplier Product No.: sc309020
$2,386.89
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PTPRD cDNA Clone in Mammalian Expression Vector (ABIN3381714)

Gene

PTPRD (Protein tyrosine Phosphatase, Receptor Type, D (PTPRD))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc309020

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PTPRD is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    7000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wang, Wang, Zhou, Pan, Qian, Fu, Zhang, Zhu, Liu, Wang, Jin, He, Wu, Shi: "Reduced expression of PTPRD correlates with poor prognosis in gastric adenocarcinoma." in: PLoS ONE, Vol. 9, Issue 11, pp. e113754, (2014) (PubMed).

  • Target

    PTPRD (Protein tyrosine Phosphatase, Receptor Type, D (PTPRD))

    Alternative Name

    PTPRD

    Background

    The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jan 2010].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_002839, NP_002830
You are here: