Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SCN3A cDNA Clone in Mammalian Expression Vector

This is a Sodium Channel, Voltage-Gated, Type III, alpha Subunit plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 8900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381758
Supplier Product No.: sc316038
$2,435.40
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SCN3A cDNA Clone in Mammalian Expression Vector (ABIN3381758)

Gene

SCN3A (Sodium Channel, Voltage-Gated, Type III, alpha Subunit (SCN3A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316038

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SCN3A is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    8900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Chen, Shi, Xu, Chen, Gao, Sun, Tang, Zeng, Liao: "Electrophysiological Differences between the Same Pore Region Mutation in SCN1A and SCN3A." in: Molecular neurobiology, Vol. 51, Issue 3, pp. 1263-70, (2015) (PubMed).

    Camargos, Bosmans, Rego, Mourão, Schwartz: "The Scorpion Toxin Tf2 from Tityus fasciolatus Promotes Nav1.3 Opening." in: PLoS ONE, Vol. 10, Issue 6, pp. e0128578, (2015) (PubMed).

  • Target

    SCN3A (Sodium Channel, Voltage-Gated, Type III, alpha Subunit (SCN3A))

    Alternative Name

    SCN3A

    Background

    Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3), also known as the neonatal form, uses an alternate in-frame splice site in the central coding region and an alternate form of an exon in the 5' coding region, compared to variant 1. The resulting isoform (3) is shorter than isoform 1, and contains one amino acid substitution relative to isoform 2.

    NCBI Accession

    NM_001081677, NP_001075146
You are here: