Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SIGMAR1 cDNA Clone in Mammalian Expression Vector

This is a sigma Non-Opioid Intracellular Receptor 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381777
Supplier Product No.: sc111748
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SIGMAR1 cDNA Clone in Mammalian Expression Vector (ABIN3381777)

Gene

SIGMAR1 (sigma Non-Opioid Intracellular Receptor 1 (SIGMAR1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111748

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SIGMAR1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Mishra, Mavlyutov, Singh, Biener, Yang, Oliver, Ruoho, Raicu: "The sigma-1 receptors are present in monomeric and oligomeric forms in living cells in the presence and absence of ligands." in: The Biochemical journal, Vol. 466, Issue 2, pp. 263-71, (2015) (PubMed).

    Kimura, Fujita, Shibata, Mori, Yamashita: "Sigma-1 receptor enhances neurite elongation of cerebellar granule neurons via TrkB signaling." in: PLoS ONE, Vol. 8, Issue 10, pp. e75760, (2013) (PubMed).

  • Target

    SIGMAR1 (sigma Non-Opioid Intracellular Receptor 1 (SIGMAR1))

    Alternative Name

    SIGMAR1

    Background

    This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor, it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013].Transcript Variant: This variant (1) encodes the longest isoform (1).

    NCBI Accession

    NM_005866, NP_005857
You are here: