Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human Src cDNA Clone in Mammalian Expression Vector

This is a Proto-oncogene tyrosine-protein kinase Src plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 5500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381815
Supplier Product No.: sc125208
$495.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human Src cDNA Clone in Mammalian Expression Vector (ABIN3381815)

Gene

Src (Proto-oncogene tyrosine-protein kinase Src (Src))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125208

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SRC is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    5500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Chellappa, Jankova, Schnabl, Pan, Brelivet, Fung, Chan, Dent, Clarke, Robertson, Sladek: "Src tyrosine kinase phosphorylation of nuclear receptor HNF4α correlates with isoform-specific loss of HNF4α in human colon cancer." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, Issue 7, pp. 2302-7, (2012) (PubMed).

    Bögel, Gujdár, Geiszt, Lányi, Fekete, Sipeki, Downward, Buday: "Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration." in: The Journal of biological chemistry, Vol. 287, Issue 37, pp. 31321-9, (2012) (PubMed).

  • Target

    Src (Proto-oncogene tyrosine-protein kinase Src (Src))

    Alternative Name

    SRC

    Target Type

    Viral Protein

    Background

    This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.

    NCBI Accession

    NM_005417, NP_005408
You are here: