Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TLR4 cDNA Clone in Mammalian Expression Vector

This is a Toll-Like Receptor 4 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 6000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381869
Supplier Product No.: sc311493
$1,141.47
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TLR4 cDNA Clone in Mammalian Expression Vector (ABIN3381869)

Gene

TLR4 (Toll-Like Receptor 4 (TLR4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc311493

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TLR4 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Liu, Yan, Liu, Wang, Li, Deng, Singh, Coleman, Rodgers: "Olfactomedin 4 down-regulates innate immunity against Helicobacter pylori infection." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 24, pp. 11056-61, (2010) (PubMed).

    Hodgkinson, Laxton, Patel, Ye: "Advanced glycation end-product of low density lipoprotein activates the toll-like 4 receptor pathway implications for diabetic atherosclerosis." in: Arteriosclerosis, thrombosis, and vascular biology, Vol. 28, Issue 12, pp. 2275-81, (2008) (PubMed).

  • Target

    TLR4 (Toll-Like Receptor 4 (TLR4))

    Alternative Name

    TLR4

    Background

    The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012].Transcript Variant: This variant (1) encodes the longest isoform (A).

    NCBI Accession

    NM_138554, NP_612564
You are here: