Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TRPV1 cDNA Clone in Mammalian Expression Vector

This is a Transient Receptor Potential Cation Channel, Subfamily V, Member 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381902
Supplier Product No.: sc128105
$761.31
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TRPV1 cDNA Clone in Mammalian Expression Vector (ABIN3381902)

Gene

TRPV1 (Transient Receptor Potential Cation Channel, Subfamily V, Member 1 (TRPV1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc128105

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TRPV1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Moon, Kim, Son, Kweon, Kim, Kim, Shim, Suh, Rhyu: "Five hTRPA1 Agonists Found in Indigenous Korean Mint, Agastache rugosa." in: PLoS ONE, Vol. 10, Issue 5, pp. e0127060, (2015) (PubMed).

    Chen, Sun, Gianaris, Riley, Cummins, Fehrenbacher, Obukhov: "Furanocoumarins are a novel class of modulators for the transient receptor potential vanilloid type 1 (TRPV1) channel." in: The Journal of biological chemistry, Vol. 289, Issue 14, pp. 9600-10, (2014) (PubMed).

    Yu, Carter, Youssef, Dyck, Light: "Intracellular long-chain acyl CoAs activate TRPV1 channels." in: PLoS ONE, Vol. 9, Issue 5, pp. e96597, (2014) (PubMed).

  • Target

    TRPV1 (Transient Receptor Potential Cation Channel, Subfamily V, Member 1 (TRPV1))

    Alternative Name

    TRPV1

    Background

    Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) contains a different segment in the 5' UTR, compared to variant 3. Variants 1-4 all encode the same protein.

    NCBI Accession

    NM_080704, NP_542435
You are here: