Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TRPV3 cDNA Clone in Mammalian Expression Vector

This is a Transient Receptor Potential Cation Channel, Subfamily V, Member 3 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381904
Supplier Product No.: sc316997
$716.76
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 2 to 4 Business Days

Quick Overview for Human TRPV3 cDNA Clone in Mammalian Expression Vector (ABIN3381904)

Gene

TRPV3 (Transient Receptor Potential Cation Channel, Subfamily V, Member 3 (TRPV3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316997

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TRPV3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Terada, Horie, Takayama, Uchida, Tominaga, Watanabe: "Activation and inhibition of thermosensitive TRP channels by voacangine, an alkaloid present in Voacanga africana, an African tree." in: Journal of natural products, Vol. 77, Issue 2, pp. 285-97, (2014) (PubMed).

    Terada, Hosono, Seki, Ariga, Ito, Narukawa, Watanabe: "Sulphur-containing compounds of durian activate the thermogenesis-inducing receptors TRPA1 and TRPV1." in: Food chemistry, Vol. 157, pp. 213-20, (2014) (PubMed).

  • Target

    TRPV3 (Transient Receptor Potential Cation Channel, Subfamily V, Member 3 (TRPV3))

    Alternative Name

    TRPV3

    Background

    This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012].Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1.

    NCBI Accession

    NM_145068, NP_659505
You are here: