Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human WT1 cDNA Clone in Mammalian Expression Vector

This is a Wilms Tumor 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3381950
Supplier Product No.: sc305117
$461.34
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human WT1 cDNA Clone in Mammalian Expression Vector (ABIN3381950)

Gene

WT1 (Wilms Tumor 1 (WT1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc305117

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human WT1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    WT1 (Wilms Tumor 1 (WT1))

    Alternative Name

    WT1

    Background

    This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015].Transcript Variant: This variant (C) lacks exon 5 but contains the additional sequence (encoding KTS) at the end of exon 9. It maintains the same reading frame and encodes an isoform (C) that is 17 aa shorter than the longest WT1 isoform (D). This variant initiates translation from a non-AUG (CUG) site, and also from a downstream, in-frame AUG.

    NCBI Accession

    NM_024425, NP_077743
You are here: