Human ADORA2A cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ADORA2A cDNA Clone in Mammalian Expression Vector (ABIN3381974)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119757
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ADORA2A is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: ECoRI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "A2A adenosine receptors and C/EBPbeta are crucially required for IL-10 production by macrophages exposed to Escherichia coli." in: Blood, Vol. 110, Issue 7, pp. 2685-95, (2007) (PubMed).
-
: "A2A adenosine receptors and C/EBPbeta are crucially required for IL-10 production by macrophages exposed to Escherichia coli." in: Blood, Vol. 110, Issue 7, pp. 2685-95, (2007) (PubMed).
-
- Adenosine A2a Receptor (ADORA2A)
-
Alternative Name
- ADORA2A
-
Background
- This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants, 1, 2, 3, 4, and 5 encode the same protein.
-
NCBI Accession
- NM_000675, NP_000666
Target
-