Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SMN2 cDNA Clone in Mammalian Expression Vector

This is a Survival of Motor Neuron 2, Centromeric plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382140
Supplier Product No.: sc112583
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human SMN2 cDNA Clone in Mammalian Expression Vector (ABIN3382140)

Gene

SMN2 (Survival of Motor Neuron 2, Centromeric (SMN2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc112583

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SMN2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    SMN2 (Survival of Motor Neuron 2, Centromeric (SMN2))

    Alternative Name

    SMN2

    Background

    This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. While mutations in the telomeric copy are associated with spinal muscular atrophy, mutations in this gene, the centromeric copy, do not lead to disease. This gene may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The full length protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Four transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Sep 2008].Transcript Variant: This variant (d) represents the longest transcript and encodes the longest isoform (d).

    NCBI Accession

    NM_017411, NP_059107
You are here: