Human KRTAP26 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human KRTAP26 cDNA Clone in Mammalian Expression Vector (ABIN3382284)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc320111
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human KRTAP26 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: KpnI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human KRTAP26 shRNA in Retroviral Vector (GFP tag)]()
Human KRTAP26 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human KRTAP26 shRNA in Lentiviral Vector (GFP tag)]()
Human KRTAP26 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Mouse KRTAP26 shRNA in Retroviral Vector]()
Mouse KRTAP26 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human KRTAP26 shRNA in Retroviral Vector]()
Human KRTAP26 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Mouse KRTAP26 shRNA in Lentiviral Vector (GFP tag)]()
Mouse KRTAP26 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human KRTAP26 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human KRTAP26 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
![Mouse KRTAP26 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse KRTAP26 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
![Mouse KRTAP26 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse KRTAP26 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- KRTAP26
-
Background
- In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins. [UniProtKB/Swiss-Prot Function]
-
NCBI Accession
- NM_203405, NP_981950
Target
-
