Human ADD3 cDNA Clone in Mammalian Expression Vector
This is a Adducin 3 (Gamma) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3382381
Supplier Product No.: sc127707
$917.73
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ADD3 cDNA Clone in Mammalian Expression Vector (ABIN3382381)
Gene
ADD3
(Adducin 3 (Gamma) (ADD3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc127707
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ADD3 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- ADD3 (Adducin 3 (Gamma) (ADD3))
-
Alternative Name
- ADD3
-
Background
- Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate transcriptional start site and contains an alternate exon in the 5' UTR, compared to variant 1. It also lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 3 encode the same protein.
-
NCBI Accession
- NM_019903, NP_063968
Target
-
You are here:
